Microbacterium phage BigBoyz
Add or modify phage thumbnail images to appear at the top of this page.
Know something about this phage that we don't? Modify its data.
| Detailed Information for Phage BigBoyz | |
| Discovery Information | |
| Isolation Host | Microbacterium foliorum NRRL B-24224 |
| Found By | Isabella Young, Evan Cessna, Rhiannon Mayer |
| Year Found | 2023 |
| Location Found | Greenville, PA United States |
| Finding Institution | Thiel College |
| Program | Science Education Alliance-Phage Hunters Advancing Genomics and Evolutionary Science |
| From enriched soil sample? | Yes |
| Isolation Temperature | 28°C |
| GPS Coordinates | 41.389611 N, 80.410278 W Map |
| Sequencing Information | |
| Sequencing Complete? | Yes |
| Date Sequencing Completed | Mar 19, 2024 |
| Sequencing Facility | Pittsburgh Bacteriophage Institute |
| Shotgun Sequencing Method | Illumina |
| Approximate Shotgun Coverage | 4557 |
| Genome length (bp) | 17059 |
| Character of genome ends | 3' Sticky Overhang |
| Overhang Length | 20 bases |
| Overhang Sequence | CCCCGCCTTCGGCTCCAACA |
| GC Content | 67.9% |
| Fasta file available? | Yes: Download fasta file |
| Characterization | |
| Cluster | GH |
| Subcluster | -- |
| Cluster Life Cycle | Unknown |
| Other Cluster Members |
Click to View |
| Annotating Institution | Thiel College |
| Annotation Status | Overdue (Expected completion by 9/19/2024) |
| Plaque Notes | 10^-5 on 10^-3 lysate clumped colonies foggy spot in center of plaques |
| Number of Genes | 25 |
| Number of tRNAs | 0 |
| Number of tmRNAs | 0 |
| Has been Phamerated? | Yes |
| Gene List | |
| Publication Info | |
| Uploaded to GenBank? | No |
| GenBank Accession | None yet |
| Refseq Number | None yet |
| Archiving Info | |
| Archiving status | Archived |
| Pitt Freezer Box# | 166 |
| Pitt Freezer Box Grid# | C1 |
| Available Files | |
| Plaque Picture | Download |
