Microbacterium phage BigBoyz
Add or modify phage thumbnail images to appear at the top of this page.
Know something about this phage that we don't? Modify its data.
Detailed Information for Phage BigBoyz | |
Discovery Information | |
Isolation Host | Microbacterium foliorum NRRL B-24224 |
Found By | Isabella Young, Evan Cessna, Rhiannon Mayer |
Year Found | 2023 |
Location Found | Greenville, PA United States |
Finding Institution | Thiel College |
Program | Science Education Alliance-Phage Hunters Advancing Genomics and Evolutionary Science |
From enriched soil sample? | Yes |
Isolation Temperature | 28°C |
GPS Coordinates | 41.389611 N, 80.410278 W Map |
Sequencing Information | |
Sequencing Complete? | Yes |
Date Sequencing Completed | Mar 19, 2024 |
Sequencing Facility | Pittsburgh Bacteriophage Institute |
Shotgun Sequencing Method | Illumina Sequencing |
Approximate Shotgun Coverage | 4557 |
Genome length (bp) | 17059 |
Character of genome ends | 3' Sticky Overhang |
Overhang Length | 20 bases |
Overhang Sequence | CCCCGCCTTCGGCTCCAACA |
GC Content | 67.9% |
Fasta file available? | Yes: Download fasta file |
Characterization | |
Cluster | GH |
Subcluster | -- |
Cluster Life Cycle | Unknown |
Other Cluster Members |
Click to View |
Annotating Institution | Thiel College |
Annotation Status | Being Annotated (Expected completion by 9/19/2024) |
Plaque Notes | 10^-5 on 10^-3 lysate clumped colonies foggy spot in center of plaques |
Has been Phamerated? | Yes |
Gene List |
Click to ViewBigBoyz_Draft_1 BigBoyz_Draft_2 BigBoyz_Draft_3 BigBoyz_Draft_4 BigBoyz_Draft_5 BigBoyz_Draft_6 BigBoyz_Draft_7 BigBoyz_Draft_8 BigBoyz_Draft_9 BigBoyz_Draft_10 BigBoyz_Draft_11 BigBoyz_Draft_12 BigBoyz_Draft_13 BigBoyz_Draft_14 BigBoyz_Draft_15 BigBoyz_Draft_16 BigBoyz_Draft_17 BigBoyz_Draft_18 BigBoyz_Draft_19 BigBoyz_Draft_20 BigBoyz_Draft_21 BigBoyz_Draft_22 BigBoyz_Draft_23 BigBoyz_Draft_24 BigBoyz_Draft_25 |
Publication Info | |
Uploaded to GenBank? | No |
GenBank Accession | None yet |
Refseq Number | None yet |
Archiving Info | |
Archiving status | Archived |
Pitt Freezer Box# | 166 |
Pitt Freezer Box Grid# | C1 |
Available Files | |
Plaque Picture | Download |