Microbacterium phage BigBoyz
Know something about this phage that we don't? Modify its data.
Detailed Information for Phage BigBoyz
Discovery Information
Isolation HostMicrobacterium foliorum NRRL B-24224
Found ByIsabella Young, Evan Cessna, Rhiannon Mayer
Year Found2023
Location FoundGreenville, PA United States
Finding InstitutionThiel College
ProgramScience Education Alliance-Phage Hunters Advancing Genomics and Evolutionary Science
From enriched soil sample?Yes
Isolation Temperature28°C
GPS Coordinates41.389611 N, 80.410278 W Map
Sequencing Information
Sequencing Complete?Yes
Date Sequencing CompletedMar 19, 2024
Sequencing FacilityPittsburgh Bacteriophage Institute
Shotgun Sequencing MethodIllumina Sequencing
Approximate Shotgun Coverage4557
Genome length (bp)17059
Character of genome ends3' Sticky Overhang
Overhang Length20 bases
Overhang SequenceCCCCGCCTTCGGCTCCAACA
GC Content67.9%
Fasta file available?Yes: Download fasta file
Characterization
ClusterGH
Subcluster--
Cluster Life CycleUnknown
Other Cluster Members

Click to View

Annotating InstitutionThiel College
Annotation StatusBeing Annotated (Expected completion by 9/19/2024)
Plaque Notes10^-5 on 10^-3 lysate
clumped colonies
foggy spot in center of plaques
Has been Phamerated?Yes
Gene List
Publication Info
Uploaded to GenBank?No
GenBank AccessionNone yet
Refseq NumberNone yet
Archiving Info
Archiving status Archived
Pitt Freezer Box# 166
Pitt Freezer Box Grid# C1
Available Files
Plaque PictureDownload