Microbacterium phage MoRicky
Add or modify phage thumbnail images to appear at the top of this page.
Know something about this phage that we don't? Modify its data.
| Detailed Information for Phage MoRicky | |
| Discovery Information | |
| Isolation Host | Microbacterium paraoxydans NWU1 |
| Found By | Maisie Ohlrich |
| Year Found | 2021 |
| Location Found | Lincoln, NE United States |
| Finding Institution | Nebraska Wesleyan University |
| Program | Science Education Alliance-Phage Hunters Advancing Genomics and Evolutionary Science |
| From enriched soil sample? | Unknown |
| Isolation Temperature | 20°C |
| GPS Coordinates | 40.825354 N, 96.704576 W Map |
| Discovery Notes | Discovered in soil around backyard tree stump |
| Naming Notes | The name I chose for this phage stems from my personal name and initials. |
| Sequencing Information | |
| Sequencing Complete? | Yes |
| Date Sequencing Completed | Feb 16, 2023 |
| Sequencing Facility | Pittsburgh Bacteriophage Institute |
| Shotgun Sequencing Method | Illumina |
| Approximate Shotgun Coverage | 6071 |
| Genome length (bp) | 17435 |
| Character of genome ends | 3' Sticky Overhang |
| Overhang Length | 20 bases |
| Overhang Sequence | CCCCGCCTTCGGCTCCAAGA |
| GC Content | 68.3% |
| Fasta file available? | Yes: Download fasta file |
| Characterization | |
| Cluster | GH |
| Subcluster | -- |
| Cluster Life Cycle | Unknown |
| Other Cluster Members |
Click to View |
| Annotating Institution | Nebraska Wesleyan University |
| Annotation Status | Overdue (Expected completion by 5/1/2023) |
| Plaque Notes | Clear plaques, small size |
| Number of Genes | 31 |
| Number of tRNAs | 0 |
| Number of tmRNAs | 0 |
| Has been Phamerated? | Yes |
| Gene List |
Click to ViewMoRicky_1 MoRicky_2 MoRicky_3 MoRicky_4 MoRicky_5 MoRicky_6 MoRicky_7 MoRicky_8 MoRicky_9 MoRicky_10 MoRicky_11 MoRicky_12 MoRicky_13 MoRicky_14 MoRicky_15 MoRicky_16 MoRicky_17 MoRicky_18 MoRicky_19 MoRicky_20 MoRicky_21 MoRicky_22 MoRicky_23 MoRicky_24 MoRicky_25 MoRicky_26 MoRicky_27 MoRicky_28 MoRicky_29 MoRicky_30 MoRicky_31 |
| Publication Info | |
| Uploaded to GenBank? | No |
| GenBank Accession | None yet |
| Refseq Number | None yet |
| Archiving Info | |
| Archiving status | Not in Pitt Archives |