Microbacterium phage MoRicky
Add or modify phage thumbnail images to appear at the top of this page.
Know something about this phage that we don't? Modify its data.
Detailed Information for Phage MoRicky | |
Discovery Information | |
Isolation Host | Microbacterium paraoxydans NWU1 |
Found By | Maisie Ohlrich |
Year Found | 2021 |
Location Found | Lincoln, NE United States |
Finding Institution | Nebraska Wesleyan University |
Program | Science Education Alliance-Phage Hunters Advancing Genomics and Evolutionary Science |
From enriched soil sample? | Unknown |
Isolation Temperature | 20°C |
GPS Coordinates | 40.825354 N, 96.704576 W Map |
Discovery Notes | Discovered in soil around backyard tree stump |
Naming Notes | The name I chose for this phage stems from my personal name and initials. |
Sequencing Information | |
Sequencing Complete? | Yes |
Date Sequencing Completed | Feb 16, 2023 |
Sequencing Facility | Pittsburgh Bacteriophage Institute |
Shotgun Sequencing Method | Illumina |
Sequencer Used | Illumina MiSeq |
Read Type | Single-end reads |
Read Length | 150 bp |
Approximate Shotgun Coverage | 6071 |
Genome length (bp) | 17435 |
Character of genome ends | 3' Sticky Overhang |
Overhang Length | 20 bases |
Overhang Sequence | CCCCGCCTTCGGCTCCAAGA |
GC Content | 68.3% |
Fasta file available? | Yes: Download fasta file |
Characterization | |
Cluster | GH |
Subcluster | -- |
Cluster Life Cycle | Unknown |
Other Cluster Members |
Click to View |
Annotating Institution | Unknown or unassigned |
Annotation Status | Planless |
Plaque Notes | Clear plaques, small size |
Number of Genes | 31 |
Number of tRNAs | 0 |
Number of tmRNAs | 0 |
Has been Phamerated? | Yes |
Gene List |
Click to ViewMoRicky_1 MoRicky_2 MoRicky_3 MoRicky_4 MoRicky_5 MoRicky_6 MoRicky_7 MoRicky_8 MoRicky_9 MoRicky_10 MoRicky_11 MoRicky_12 MoRicky_13 MoRicky_14 MoRicky_15 MoRicky_16 MoRicky_17 MoRicky_18 MoRicky_19 MoRicky_20 MoRicky_21 MoRicky_22 MoRicky_23 MoRicky_24 MoRicky_25 MoRicky_26 MoRicky_27 MoRicky_28 MoRicky_29 MoRicky_30 MoRicky_31 |
Publication Info | |
Uploaded to GenBank? | No |
GenBank Accession | None yet |
Refseq Number | None yet |
Archiving Info | |
Archiving status | Not in Pitt Archives |