Microbacterium phage MoRicky
Know something about this phage that we don't? Modify its data.
Detailed Information for Phage MoRicky
Discovery Information
Isolation HostMicrobacterium paraoxydans NWU1
Found ByMaisie Ohlrich
Year Found2021
Location FoundLincoln, NE United States
Finding InstitutionNebraska Wesleyan University
ProgramScience Education Alliance-Phage Hunters Advancing Genomics and Evolutionary Science
From enriched soil sample?Unknown
Isolation Temperature20°C
GPS Coordinates40.825354 N, 96.704576 W Map
Discovery NotesDiscovered in soil around backyard tree stump
Naming NotesThe name I chose for this phage stems from my personal name and initials.
Sequencing Information
Sequencing Complete?Yes
Date Sequencing CompletedFeb 16, 2023
Sequencing FacilityPittsburgh Bacteriophage Institute
Shotgun Sequencing MethodIllumina Sequencing
Approximate Shotgun Coverage6071
Genome length (bp)17435
Character of genome ends3' Sticky Overhang
Overhang Length20 bases
Overhang SequenceCCCCGCCTTCGGCTCCAAGA
GC Content68.3%
Fasta file available?Yes: Download fasta file
Characterization
ClusterGH
Subcluster--
Cluster Life CycleUnknown
Other Cluster Members

Click to View

Annotating InstitutionNebraska Wesleyan University
Annotation StatusOverdue (Expected completion by 5/1/2023)
Plaque NotesClear plaques, small size
Number of Genes31
Number of tRNAs0
Number of tmRNAs0
Has been Phamerated?Yes
Gene List
Publication Info
Uploaded to GenBank?No
GenBank AccessionNone yet
Refseq NumberNone yet
Archiving Info
Archiving status Not in Pitt Archives