Microbacterium phage Smilerella
Add or modify phage thumbnail images to appear at the top of this page.
Know something about this phage that we don't? Modify its data.
| Detailed Information for Phage Smilerella | |
| Discovery Information | |
| Isolation Host | Microbacterium paraoxydans NWU1 |
| Found By | Ella Ford |
| Year Found | 2021 |
| Location Found | Lincoln, NE USA |
| Finding Institution | Nebraska Wesleyan University |
| Program | Science Education Alliance-Phage Hunters Advancing Genomics and Evolutionary Science |
| From enriched soil sample? | Yes |
| Isolation Temperature | 37°C |
| GPS Coordinates | 40.83853 N, 96.64983 W Map |
| Discovery Notes | The soil sample was taken from under a tree |
| Naming Notes | Smiler-Ella was my nickname growing up because I was such a smiley kid so I decided to combine the two words to create my phage name :) |
| Sequencing Information | |
| Sequencing Complete? | Yes |
| Date Sequencing Completed | Feb 16, 2023 |
| Sequencing Facility | Pittsburgh Bacteriophage Institute |
| Shotgun Sequencing Method | Illumina |
| Sequencer Used | Illumina MiSeq |
| Read Type | Single-end reads |
| Read Length | 150 bp |
| Approximate Shotgun Coverage | 5967 |
| Genome length (bp) | 17525 |
| Character of genome ends | 3' Sticky Overhang |
| Overhang Length | 20 bases |
| Overhang Sequence | CCCCGCCTTCGGCTCCAAGA |
| GC Content | 68.3% |
| Fasta file available? | Yes: Download fasta file |
| Characterization | |
| Cluster | GH |
| Subcluster | -- |
| Cluster Life Cycle | Unknown |
| Other Cluster Members |
Click to View |
| Annotating Institution | Western Carolina University |
| Annotation Status | Being Annotated (Expected completion by 2/4/2026) |
| Number of Genes | 29 |
| Number of tRNAs | 0 |
| Number of tmRNAs | 0 |
| Has been Phamerated? | Yes |
| Gene List |
Click to ViewSmilerella_1 Smilerella_2 Smilerella_3 Smilerella_4 Smilerella_5 Smilerella_6 Smilerella_7 Smilerella_8 Smilerella_9 Smilerella_10 Smilerella_11 Smilerella_12 Smilerella_13 Smilerella_14 Smilerella_15 Smilerella_16 Smilerella_17 Smilerella_18 Smilerella_19 Smilerella_20 Smilerella_21 Smilerella_22 Smilerella_23 Smilerella_24 Smilerella_25 Smilerella_26 Smilerella_27 Smilerella_28 Smilerella_29 |
| Publication Info | |
| Uploaded to GenBank? | No |
| GenBank Accession | None yet |
| Refseq Number | None yet |
| Archiving Info | |
| Archiving status | Archived |
| Pitt Freezer Box# | 215 |
| Pitt Freezer Box Grid# | A6 |
| Available Files | |
| Plaque Picture | Download |
| EM Picture | Download |
