Microbacterium phage Smilerella
Add or modify phage thumbnail images to appear at the top of this page.
Know something about this phage that we don't? Modify its data.
Detailed Information for Phage Smilerella | |
Discovery Information | |
Isolation Host | Microbacterium paraoxydans NWU1 |
Found By | Ella Ford |
Year Found | 2021 |
Location Found | Lincoln, NE USA |
Finding Institution | Nebraska Wesleyan University |
Program | Science Education Alliance-Phage Hunters Advancing Genomics and Evolutionary Science |
From enriched soil sample? | Yes |
Isolation Temperature | 37°C |
GPS Coordinates | 40.83853 N, 96.64983 W Map |
Discovery Notes | The soil sample was taken from under a tree |
Naming Notes | Smiler-Ella was my nickname growing up because I was such a smiley kid so I decided to combine the two words to create my phage name :) |
Sequencing Information | |
Sequencing Complete? | Yes |
Date Sequencing Completed | Feb 16, 2023 |
Sequencing Facility | Pittsburgh Bacteriophage Institute |
Shotgun Sequencing Method | Illumina |
Approximate Shotgun Coverage | 5967 |
Genome length (bp) | 17525 |
Character of genome ends | 3' Sticky Overhang |
Overhang Length | 20 bases |
Overhang Sequence | CCCCGCCTTCGGCTCCAAGA |
GC Content | 68.3% |
Fasta file available? | Yes: Download fasta file |
Characterization | |
Cluster | GH |
Subcluster | -- |
Cluster Life Cycle | Unknown |
Other Cluster Members |
Click to View |
Annotating Institution | Unknown or unassigned |
Annotation Status | Planless |
Number of Genes | 29 |
Number of tRNAs | 0 |
Number of tmRNAs | 0 |
Has been Phamerated? | Yes |
Gene List |
Click to ViewSmilerella_1 Smilerella_2 Smilerella_3 Smilerella_4 Smilerella_5 Smilerella_6 Smilerella_7 Smilerella_8 Smilerella_9 Smilerella_10 Smilerella_11 Smilerella_12 Smilerella_13 Smilerella_14 Smilerella_15 Smilerella_16 Smilerella_17 Smilerella_18 Smilerella_19 Smilerella_20 Smilerella_21 Smilerella_22 Smilerella_23 Smilerella_24 Smilerella_25 Smilerella_26 Smilerella_27 Smilerella_28 Smilerella_29 |
Publication Info | |
Uploaded to GenBank? | No |
GenBank Accession | None yet |
Refseq Number | None yet |
Archiving Info | |
Archiving status | Not in Pitt Archives |
Available Files | |
Plaque Picture | Download |
EM Picture | Download |