Microbacterium phage Smilerella
Know something about this phage that we don't? Modify its data.
Detailed Information for Phage Smilerella
Discovery Information
Isolation HostMicrobacterium paraoxydans NWU1
Found ByElla Ford
Year Found2021
Location FoundLincoln, NE USA
Finding InstitutionNebraska Wesleyan University
ProgramScience Education Alliance-Phage Hunters Advancing Genomics and Evolutionary Science
From enriched soil sample?Yes
Isolation Temperature37°C
GPS Coordinates40.83853 N, 96.64983 W Map
Discovery NotesThe soil sample was taken from under a tree
Naming NotesSmiler-Ella was my nickname growing up because I was such a smiley kid so I decided to combine the two words to create my phage name :)
Sequencing Information
Sequencing Complete?Yes
Date Sequencing CompletedFeb 16, 2023
Sequencing FacilityPittsburgh Bacteriophage Institute
Shotgun Sequencing MethodIllumina
Sequencer UsedIllumina MiSeq
Read TypeSingle-end reads
Read Length150 bp
Approximate Shotgun Coverage5967
Genome length (bp)17525
Character of genome ends3' Sticky Overhang
Overhang Length20 bases
Overhang SequenceCCCCGCCTTCGGCTCCAAGA
GC Content68.3%
Fasta file available?Yes: Download fasta file
Characterization
ClusterGH
Subcluster--
Cluster Life CycleUnknown
Other Cluster Members

Click to View

Annotating InstitutionUnknown or unassigned
Annotation StatusPlanless
Number of Genes29
Number of tRNAs0
Number of tmRNAs0
Has been Phamerated?Yes
Gene List
Publication Info
Uploaded to GenBank?No
GenBank AccessionNone yet
Refseq NumberNone yet
Archiving Info
Archiving status Not in Pitt Archives
Available Files
Plaque PictureDownload
EM PictureDownload